| Sequence ID | >WENV170035715 |
| Genome ID | CDYM01028755 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 7193 |
| End posion on genome | 7277 |
| Amino Acid | Leu |
| Anticodon | TAA |
| Upstream region at tRNA start position |
ctctaaggct |
| tRNA gene sequence |
GCCCGAATGGTGGAATGGTAGACACGAAGGACTTAAAATCCTTTGGCTATTGCAGCTGTG |
| Downstream region at tRNA end position |
cataaggctg |
| Secondary structure (Cloverleaf model) | >WENV170035715 Leu TAA
t ACtg cataaggctg
G + T
C - G
C - G
C - G
G - C
A - T
A - T T G
T C C C C C A
T A A G | | | | | A
G G G T G G G G G G C
G | | | T T
T A C A C
A G G TGGCTATTGCAGCTGT
A - T
A - T
G - C
G - C
A - T
C A
T A
T A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |