| Sequence ID | >WENV170035719 |
| Genome ID | CDYM01029409 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 15096 |
| End posion on genome | 15167 |
| Amino Acid | Gln |
| Anticodon | CTG |
| Upstream region at tRNA start position |
tgaagaacat |
| tRNA gene sequence |
TGGGCTATGGTGTAATGGTAACACTACAGATTCTGGTCCTGTCATTCTAGGTTCGAGTCC |
| Downstream region at tRNA end position |
gacaagagaa |
| Secondary structure (Cloverleaf model) | >WENV170035719 Gln CTG
t ACac gacaagagaa
T - A
G - C
G - C
G - C
C - G
T - A
A - T T G
T G G T C C A
A A G | + | | | G
T T G T G C T A G G C
G | | | | T T
G A C A C
T A T CATT
A - T
C - G
A - T
G - C
A C
T T
T G
C T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |