| Sequence ID | >WENV170035741 |
| Genome ID | CDYM01030154 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 352 |
| End posion on genome | 440 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
tccgaaagaa |
| tRNA gene sequence |
GGAGAGGTGCTCGAGTGGTTGAAGAGGCACGCCTGGAAAGCGTGTATACTCCTAAAGGGT |
| Downstream region at tRNA end position |
attgtttgta |
| Secondary structure (Cloverleaf model) | >WENV170035741 Ser GGA
a GCac attgtttgta
G - C
G - C
A - T
G - C
A - T
G - C
G + T T A
T T G C T C A
T G A G | | | | | G
G G C T C A C G A G C
G | | | T T
T A G A G
T G A G TATACTCCTAAAGGGTATC
C - G
A - T
C - G
G - C
C - G
C A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |