| Sequence ID | >WENV170035753 |
| Genome ID | CDYM01030716 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 259 |
| End posion on genome | 344 |
| Amino Acid | Tyr |
| Anticodon | GTA |
| Upstream region at tRNA start position |
ctcgctttaa |
| tRNA gene sequence |
GGGCAAATACCAGAGTGGCCAAATGGGGCAGACTGTAAATCTGCTGGCTTACGCCTTCGG |
| Downstream region at tRNA end position |
aaaaattgcg |
| Secondary structure (Cloverleaf model) | >WENV170035753 Tyr GTA
a ACAA aaaaattgcg
G - C
G - C
G - C
C - G
A - T
A - T
A - T T A
T C T A C C A
T G A A | + | | | G
G G A C C G G T G G C
G | | | T T
C A T G G
C A A G TGGCTTACGCCTTC
G - C
C - G
A - T
G - C
A - T
C A
T A
G T A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |