| Sequence ID | >WENV170035786 |
| Genome ID | CDYM01032024 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 322 |
| End posion on genome | 396 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
aggatacatc |
| tRNA gene sequence |
GGACTTGTAGCTCAGTTGGTTAGAGCAACAGACTCATAATCTGGAGGTCCCAGGTTCAAG |
| Downstream region at tRNA end position |
tcaaaatcaa |
| Secondary structure (Cloverleaf model) | >WENV170035786 Met CAT
c ACtt tcaaaatcaa
G - C
G - C
A - T
C - G
T + G
T T
G - C C G
T G G T C C A
T G A A | | | | | A
T C T C G C C A G G C
G | | | | T T
G G A G C
T T A A AGGTC
A G
C - G
A - T
G - C
A - T
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |