| Sequence ID | >WENV170035795 |
| Genome ID | CDYM01032585 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 172277 |
| End posion on genome | 172200 |
| Amino Acid | Pro |
| Anticodon | CGG |
| Upstream region at tRNA start position |
aaatattgtt |
| tRNA gene sequence |
CGGGGTGTAGCGCAGTCCGGTTAGCGCGCCAGCTTCGGGAGTTGGAGGTCGCTGGTTCGA |
| Downstream region at tRNA end position |
aaatcaaaac |
| Secondary structure (Cloverleaf model) | >WENV170035795 Pro CGG
t ACAA aaatcaaaac
C - G
G - C
G - C
G - C
G - C
T T
G - C T A
T T G A C C A
C T G A A + | | | | G
C C G C G G C T G G C
G | | | | T T
G G C G C
T T A G AGGTC
C - G
C - G
A - T
G + T
C - G
T A
T G
C G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |