| Sequence ID | >WENV170035845 |
| Genome ID | CDYM01035058 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 170 |
| End posion on genome | 99 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
attcagatgc |
| tRNA gene sequence |
GCTGATGTGGCTCAGAGGTAGAGCACTTCCTTGGTAAGGAAGGGGTCACGGGTTCAATTC |
| Downstream region at tRNA end position |
taccaaatat |
| Secondary structure (Cloverleaf model) | >WENV170035845 Thr GGT
c Ttta taccaaatat
G - C
C - G
T - A
G - C
A - T
T - A
G - C T T
T T G C C C A
G A G | | | | | A
A C T C G A C G G G C
G | | | | T T
G G A G C
T A A GGGTC
C - G
T - A
T - A
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |