| Sequence ID | >WENV170035888 |
| Genome ID | CDYM01037320 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 4 |
| End posion on genome | 88 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
nnnnnnnaat |
| tRNA gene sequence |
GCGGATATGGCGGAATTGGCAGACGCGCCAGATTTAGGTTCTGGTGGGAACACCCGTGCA |
| Downstream region at tRNA end position |
tatttttata |
| Secondary structure (Cloverleaf model) | >WENV170035888 Leu TAG
t ACTA tatttttata
G - C
C - G
G - C
G - C
A - T
T - A
A - T T C
T T G T C C A
T A A G + | | | | A
T G G C G G C A G G C
G | | | T T
G A C G C
C A G G TGGGAACACCCGT
C - G
C - G
A - T
G - C
A - T
T T
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |