| Sequence ID | >WENV170035905 |
| Genome ID | CDYM01038111 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 11974 |
| End posion on genome | 11898 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
ctaattggat |
| tRNA gene sequence |
TCCTGTATAGCTTAGTTGGTAAAAGCGCTACATTGGTTATGTAGATACCGGCGGTTCGAA |
| Downstream region at tRNA end position |
acttttgaag |
| Secondary structure (Cloverleaf model) | >WENV170035905 Thr GGT
t GCAA acttttgaag
T - A
C - G
C - G
T - A
G - C
T + G
A - T T A
T C C G C C A
T G A A | | | | | G
T T T C G G G C G G C
G | | | | T T
G A A G C
T A A G ATACC
C - G
T - A
A - T
C - G
A - T
T A
T T
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |