| Sequence ID | >WENV170035916 |
| Genome ID | CDYM01038707 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 2901 |
| End posion on genome | 2813 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
atatatttat |
| tRNA gene sequence |
GGTTGCGTGGCGTAATGGTAGCGCAATGCCCTGCTAAGGCATCCACGGCGTTGAGTCGTG |
| Downstream region at tRNA end position |
gataatttca |
| Secondary structure (Cloverleaf model) | >WENV170035916 Ser GCT
t GCCA gataatttca
G - C
G - C
T - A
T - A
G + T
C - G
G - C T G
T C C C T C A
A A G | | | | | G
T T G C G G G G A G C
G + | | | T T
G G C G C
T A A CCACGGCGTTGAGTCGTGT
A - T
T - A
G - C
C - G
C - G
C A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |