| Sequence ID | >WENV170035924 |
| Genome ID | CDYM01039316 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 45 |
| End posion on genome | 120 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
tgttttatat |
| tRNA gene sequence |
AGCGGAGTGGAGCAGTTGGTAGCTCATTAGGTTCATAACCCAGAAGGCGCAGGTTCAAGT |
| Downstream region at tRNA end position |
aaaatgcttc |
| Secondary structure (Cloverleaf model) | >WENV170035924 Met CAT
t ACCA aaaatgcttc
A A
G - C
C - G
G - C
G - C
A - T
G - C T G
T C G T C C A
T G A G | | | | | A
T C G A G G C A G G C
G | | | | T T
G G C T C
T A A AAGGC
T + G
T - A
A C
G - C
G - C
T A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |