| Sequence ID | >WENV170035925 |
| Genome ID | CDYM01039328 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 23395 |
| End posion on genome | 23470 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
acaacatgat |
| tRNA gene sequence |
GGTGCCATAGCTCAGTTGGTAGAGCAAAGGACTGAAAATCCTTGTGTCCCCGGTTCGATT |
| Downstream region at tRNA end position |
aaaagctttt |
| Secondary structure (Cloverleaf model) | >WENV170035925 Phe GAA
t ACCA aaaagctttt
G - C
G - C
T - A
G - C
C - G
C - G
A - T T T
T G G T C C A
T G A A | | | | G
T C T C G C C C G G C
G | | | | T T
G G A G C
T A A GTGTC
A - T
A - T
G - C
G - C
A - T
C A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |