| Sequence ID | >WENV170035926 |
| Genome ID | CDYM01039328 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 23187 |
| End posion on genome | 23113 |
| Amino Acid | Pro |
| Anticodon | CGG |
| Upstream region at tRNA start position |
aaacaaaaaa |
| tRNA gene sequence |
CGGGATGTAGCACAGTTGGCTAGCGCGCCACGTTCGGGACGTGGAGGTCGGAAGTTCGAG |
| Downstream region at tRNA end position |
atcaaaaagg |
| Secondary structure (Cloverleaf model) | >WENV170035926 Pro CGG
a ACtc atcaaaaagg
C - G
G - C
G - C
G - C
A - T
T - A
G - C T G
T T C T T C A
T G A A + | | | | G
T C A C G G G A A G C
G | | | T T
G G C G C
C T A G AGGTC
C - G
C - G
A - T
C - G
G - C
T A
T G
C G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |