Sequence ID | >WENV170039392 |
Genome ID | CDYR01041676 |
Search identical group | |
Phylum/Class | [CDYR] gut metagenome; human stools |
Species | |
Start position on genome | 1219 |
End posion on genome | 1125 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
agcttagcgc |
tRNA gene sequence |
GGAAAGGTGTCCGAGTCGGCCGAAGGAGCTCGCCTGCTAAGTGAGTATACGGGCTTAAAC |
Downstream region at tRNA end position |
tctgccatca |
Secondary structure (Cloverleaf model) | >WENV170039392 Ser GCT c GCCA tctgccatca G - C G - C A - T A - T A - T G - C G - C T A T C T C C C A C T G A G | | | | | A G G C C T G A G G G C G | | | T T C A G G A C G A G TATACGGGCTTAAACCTGTATC C - G T - A C - G G + T C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |