Sequence ID | >W141383444 |
Genome ID | JDFQ01000042 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lacticaseibacillus rhamnosus PEL5 [JDFQ] |
Start position on genome | 746 |
End posion on genome | 821 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
caattaataT |
tRNA gene sequence |
GGTTCCATGGTCTAGTTGGTTAGGACGCCTGCCTGTCACGCAGGAGATCACGGGTTCGAG |
Downstream region at tRNA end position |
gcggctcggt |
Secondary structure (Cloverleaf model) | >W141383444 Asp GTC T GTtt gcggctcggt G - C G - C T - A T + G C - G C - G A - T T G T T G C C C A T G A G | | | | | G T T C T G A C G G G C G + | | | T T G G G A C T T A G AGATC C - G C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |