| Sequence ID | >WENV170043536 |
| Genome ID | CDYU01040687 |
| Phylum/Class | [CDYU] gut metagenome; human stools |
| Species | |
| Start position on genome | 12988 |
| End posion on genome | 13064 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
agacaacgtt |
| tRNA gene sequence |
GCGCGAGTAGCCCAGCGGATTAGAGCAGCTGACTACGGATCAGCAGGTCGCAGGTTCGAA |
| Downstream region at tRNA end position |
gccaccagtc |
| Secondary structure (Cloverleaf model) | >WENV170043536 Arg ACG
t ACCA gccaccagtc
G - C
C - G
G - C
C - G
G - C
A - T
G - C T A
T T G T C C A
C G A A + | | | | G
G C C C G G C A G G C
G | | | T T
A G A G C
T T A A AGGTC
G - C
C - G
T - A
G - C
A - T
C A
T G
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |