| Sequence ID | >WENV170045942 |
| Genome ID | CDYY01014389 |
| Phylum/Class | [CDYY] gut metagenome; human stools |
| Species | |
| Start position on genome | 14077 |
| End posion on genome | 14149 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
caaaagagtt |
| tRNA gene sequence |
GGTCTTGTAGTTCAACGGATAGAATAGAAGTTTCCTAAACTTTAGATCCGGGTTCGATTC |
| Downstream region at tRNA end position |
ttgcctttct |
| Secondary structure (Cloverleaf model) | >WENV170045942 Arg CCT
t ACtt ttgcctttct
G + T
G - C
T - A
C - G
T - A
T + G
G - C T T
T G G C C C A
C A A A | | | | | G
G C T T G C C G G G C
G | | | + T T
A G A A T
T A A AGAT
G + T
A - T
A - T
G - C
T - A
T A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |