| Sequence ID | >WENV170046341 |
| Genome ID | CDYY01032950 |
| Phylum/Class | [CDYY] gut metagenome; human stools |
| Species | |
| Start position on genome | 25223 |
| End posion on genome | 25299 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
cgctgattgT |
| tRNA gene sequence |
GGGGTCTTAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGAGGGTCACAGGTTCGAGC |
| Downstream region at tRNA end position |
tttttattca |
| Secondary structure (Cloverleaf model) | >WENV170046341 Val TAC
T ATCA tttttattca
G - C
G - C
G - C
G - C
T + G
C - G
T - A C G
T T G T C C A
C G A A | | | | | G
T C T C G A C A G G C
G | | | | T T
G G A G C
G A A GGGTC
T - A
C - G
T - A
G - C
C - G
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |