Sequence ID | >WENV170048595 |
Genome ID | CDZA01021213 |
Search identical group | |
Phylum/Class | [CDZA] gut metagenome; human stools |
Species | |
Start position on genome | 2863 |
End posion on genome | 2787 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aagcgcacat |
tRNA gene sequence |
GGCCAAGTAGTTCAGTTGGTTAGAACGCCAGCCTGTCACGCTGGAGGTCGAGGGTTCGAG |
Downstream region at tRNA end position |
catttgctgc |
Secondary structure (Cloverleaf model) | >WENV170048595 Asp GTC t GCCA catttgctgc G - C G + T C - G C - G A - T A - T G - C C G T T T C C C A T G A A + | | | | G T C T T G G A G G G C G | | | | T T G G A A C T T A G AGGTC C - G C - G A - T G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |