Sequence ID | >WENV170062961 |
Genome ID | CDZK01000472 |
Search identical group | |
Phylum/Class | [CDZK] gut metagenome; human stools |
Species | |
Start position on genome | 6899 |
End posion on genome | 6974 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
acaccgcagc |
tRNA gene sequence |
GGGTCGTTAGCTCAGCTGGTAGAGCAGCGGACTTTTAATCCGTTGGTCGTGGGTTCGAAT |
Downstream region at tRNA end position |
agagtgttcg |
Secondary structure (Cloverleaf model) | >WENV170062961 Lys TTT c ACCA agagtgttcg G - C G - C G - C T - A C - G G - C T - A T A T C G C C C A C G A A | + | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A TGGTC G + T C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |