| Sequence ID | >WENV170065382 |
| Genome ID | CDZM01000014 |
| Phylum/Class | [CDZM] gut metagenome; human stools |
| Species | |
| Start position on genome | 28245 |
| End posion on genome | 28169 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
acgtttcagg |
| tRNA gene sequence |
CGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTCGGTTCAAA |
| Downstream region at tRNA end position |
ctttccctta |
| Secondary structure (Cloverleaf model) | >WENV170065382 Met CAT
g ACCA ctttccctta
C A
G - C
C - G
G - C
G - C
G - C
G - C T A
T C G G C C A
C G A G | + | | | A
C C G A G G T C G G C
T | | | | T T
G G C T C
G T A G AGGTC
T - A
C - G
G - C
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |