| Sequence ID | >WENV170078305 |
| Genome ID | CDZV01017221 |
| Phylum/Class | [CDZV] gut metagenome; human stools |
| Species | |
| Start position on genome | 25086 |
| End posion on genome | 25169 |
| Amino Acid | Leu |
| Anticodon | TAA |
| Upstream region at tRNA start position |
tccggtcaat |
| tRNA gene sequence |
GCCCTCGTGGCGGAATGGTAGACGCTGCAGACTTAAAATCTGTTGATCGCAAGATCGTAC |
| Downstream region at tRNA end position |
cgctaaacag |
| Secondary structure (Cloverleaf model) | >WENV170078305 Leu TAA
t ACtt cgctaaacag
G + T
C - G
C - G
C - G
T + G
C - G
G - C T G
T T G G C C A
T A A G | | | | | G
G G G C G A C C G G C
G | | | T T
T A C G C
A G T TGATCGCAAGATCGT
G + T
C - G
A - T
G - C
A - T
C A
T A
T A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |