| Sequence ID | >WENV170078778 |
| Genome ID | CDZV01038765 |
| Phylum/Class | [CDZV] gut metagenome; human stools |
| Species | |
| Start position on genome | 46074 |
| End posion on genome | 46148 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
accactacat |
| tRNA gene sequence |
GGCAGGGTAGCTCAGTGGTAGAGCAGAGGACTCATAAGCCTTTGGTCGGGTGTTCAAATC |
| Downstream region at tRNA end position |
gttttgcaaa |
| Secondary structure (Cloverleaf model) | >WENV170078778 Met CAT
t ACCA gttttgcaaa
G + T
G - C
C - G
A - T
G - C
G - C
G - C T A
T T C C A C A
G A A + | | | | A
T C T C G G G G T G C
G | | | | T T
G G A G C
T A A TGGTC
G + T
A - T
G - C
G - C
A G
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |