| Sequence ID | >WENV170078891 |
| Genome ID | CDZV01043146 |
| Phylum/Class | [CDZV] gut metagenome; human stools |
| Species | |
| Start position on genome | 34352 |
| End posion on genome | 34428 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
ccataaaaat |
| tRNA gene sequence |
GGCCCGGTAGTTCAGTTGGTTAGAACGCTAGCCTGTCACGCTAGAGGTCGACGGTTCGAG |
| Downstream region at tRNA end position |
tttttgccca |
| Secondary structure (Cloverleaf model) | >WENV170078891 Asp GTC
t GCCA tttttgccca
G - C
G + T
C - G
C - G
C - G
G - C
G - C C G
T T T G C C A
T G A A + | | | | G
T C T T G G A C G G C
G | | | | T T
G G A A C
T T A G AGGTC
C - G
T - A
A - T
G - C
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |