| Sequence ID | >WENV170087574 |
| Genome ID | CEAD01009352 |
| Phylum/Class | [CEAD] gut metagenome; human stools |
| Species | |
| Start position on genome | 8619 |
| End posion on genome | 8695 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
cggaacgtat |
| tRNA gene sequence |
GCGTTGGTAGCTCAGCTGGATAGAGTGACTGACTACGAATCAGTAGGCCGGGGGTTCGAG |
| Downstream region at tRNA end position |
nnnnnnnnnn |
| Secondary structure (Cloverleaf model) | >WENV170087574 Arg ACG
t ACCA nnnnnnnnnn
G - C
C - G
G - C
T T
T - A
G - C
G - C T G
T T T C C C A
C G A A + + | | | G
T C T C G G G G G G C
G | | | + T T
G G A G T
A T A G AGGCC
A - T
C - G
T - A
G - C
A - T
C A
T A
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |