Sequence ID | >WENV170093423 |
Genome ID | CEAH01024984 |
Search identical group | |
Phylum/Class | [CEAH] gut metagenome; human stools |
Species | |
Start position on genome | 2290 |
End posion on genome | 2366 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ataactaaat |
tRNA gene sequence |
GGGCGCATAGCTCAGGTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGTTCGAG |
Downstream region at tRNA end position |
gcaagagaga |
Secondary structure (Cloverleaf model) | >WENV170093423 Ile GAT t ACCA gcaagagaga G - C G - C G - C C - G G + T C - G A - T T G T T C A C C A G G A A + | | | | G T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |