| Sequence ID | >WENV170098168 |
| Genome ID | CEAN01001165 |
| Phylum/Class | [CEAN] gut metagenome; human stools |
| Species | |
| Start position on genome | 134 |
| End posion on genome | 62 |
| Amino Acid | Glu |
| Anticodon | CTC |
| Upstream region at tRNA start position |
tataatacac |
| tRNA gene sequence |
GGTTCGTTGGTCAAGCGGTTAAGACGCCGCCCTCTCACGGCGGAAACACGGGTTCGATTC |
| Downstream region at tRNA end position |
actgatattt |
| Secondary structure (Cloverleaf model) | >WENV170098168 Glu CTC
c GCtc actgatattt
G + T
G - C
T - A
T + G
C - G
G - C
T - A T T
T T G C C C A
C G A G | | | | | G
G A C T G A C G G G C
G | | | T T
T A G A C
T A G AAAC
C - G
C - G
G - C
C - G
C - G
C C
T A
C T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |