| Sequence ID | >WENV170103088 |
| Genome ID | CEAX01035516 |
| Phylum/Class | [CEAX] gut metagenome; human stools |
| Species | |
| Start position on genome | 45403 |
| End posion on genome | 45477 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
tgtctcatat |
| tRNA gene sequence |
GGCCCGTTGGTCAAGTGGTTAAGACACGGCCCTTTCACGGCTGTAACATGGGTTCGAATC |
| Downstream region at tRNA end position |
cagttggagg |
| Secondary structure (Cloverleaf model) | >WENV170103088 Glu TTC
t ACCA cagttggagg
G - C
G + T
C - G
C - G
C - G
G - C
T - A T A
T T G C C C A
T G A G | + | | | G
G A C T G A T G G G C
G | | | T T
T A G A C
T A A TAAC
C - G
G + T
G - C
C - G
C - G
C C
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |