| Sequence ID | >WENV170103610 |
| Genome ID | CEAX01053272 |
| Phylum/Class | [CEAX] gut metagenome; human stools |
| Species | |
| Start position on genome | 35992 |
| End posion on genome | 35904 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
aaacatgcag |
| tRNA gene sequence |
GGAGAGATGCTCGAGTGGTTGAAGAGGCACGCCTGGAAAGCGTGTATACGCCAAAAGTGT |
| Downstream region at tRNA end position |
acatgaaaaa |
| Secondary structure (Cloverleaf model) | >WENV170103610 Ser GGA
g GCag acatgaaaaa
G - C
G - C
A - T
G - C
A - T
G - C
A - T T A
T G C C C C A
T G A G | | | | | G
G G C T C C G G G G C
G | | | T T
T A G A G
T G A G TATACGCCAAAAGTGTATC
C - G
A - T
C - G
G - C
C - G
C A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |