| Sequence ID | >WENV170104145 |
| Genome ID | CEAZ01022477 |
| Phylum/Class | [CEAZ] gut metagenome; human stools |
| Species | |
| Start position on genome | 154 |
| End posion on genome | 81 |
| Amino Acid | Lys |
| Anticodon | TTT |
| Upstream region at tRNA start position |
ttgtatgtga |
| tRNA gene sequence |
GGGCCCGTAGCTCAGTCTGGCAGAGCGCTTGGCTTTTAACCAAGCGGCCGCGGGTTCAAT |
| Downstream region at tRNA end position |
tctaatttta |
| Secondary structure (Cloverleaf model) | >WENV170104145 Lys TTT
a Gttt tctaatttta
G - C
G - C
G - C
C - G
C - G
C - G
G - C T T
T T G C C C A
T G A A + | | | | A
C C T C G G C G G G C
T | | | | T T
G G A G C
G C A G CGGCC
C - G
T - A
T - A
G - C
G - C
C A
T A
T T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |