| Sequence ID | >WENV170112184 |
| Genome ID | CEGD01007928 |
| Phylum/Class | [CEGD] microbial mat metagenome; grass silage |
| Species | |
| Start position on genome | 132 |
| End posion on genome | 206 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
ttttgttact |
| tRNA gene sequence |
GCCGTTGTAGCTCAGGGGTAGAGCGCTTCCTTGGTAAGGAAGAGGTCATGAGTTCAATTC |
| Downstream region at tRNA end position |
ttaaaactat |
| Secondary structure (Cloverleaf model) | >WENV170112184 Thr GGT
t TCAA ttaaaactat
G - C
C - G
C - G
G + T
T - A
T - A
G - C T T
T T A C T C A
G A A | | | | | A
G C T C G A T G A G C
G | | | | T T
G G A G C
T A G AGGTC
C - G
T - A
T - A
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |