Sequence ID | >WENV170115510 |
Genome ID | CENG01023695 |
Search identical group | |
Phylum/Class | [CENG] marine metagenome genome assembly TARA_007_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 196 |
End posion on genome | 113 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
attgaaaaac |
tRNA gene sequence |
GGGGAGATACTCAAGCGGCCAACGAGGACAGACTGTAAATCTGTTGTTTTTTAACTTCGC |
Downstream region at tRNA end position |
ttttacaagt |
Secondary structure (Cloverleaf model) | >WENV170115510 Tyr GTA c ACac ttttacaagt G - C G - C G - C G - C A - T G - C A - T T A T C G T C C A C G A A | | | | | G G A C T C G C A G G C G | | | T T C C G A G C A A G TGTTTTTTAACTTC A - T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |