Sequence ID | >WENV170122223 |
Genome ID | CENN01057871 |
Search identical group | |
Phylum/Class | [CENN] marine metagenome genome assembly TARA_023_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 215 |
End posion on genome | 288 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
atggatgaaa |
tRNA gene sequence |
CGGGATGTGGCGCAGCTTGGTAGCGCACTTCGTTCGGGACGAAGGGGCCGCAGGTTCGAA |
Downstream region at tRNA end position |
gctgatccaa |
Secondary structure (Cloverleaf model) | >WENV170122223 Pro CGG a Attg gctgatccaa C - G G - C G - C G - C A - T T - A G - C T A T T G T C C A C G A G + | | | | G T C G C G G C A G G C T | | | | T T G G C G C G T A A GGGCC C - G T - A T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |