Sequence ID | >WENV170124793 |
Genome ID | CENP01009108 |
Search identical group | |
Phylum/Class | [CENP] marine metagenome genome assembly TARA_030_DCM_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 455 |
End posion on genome | 385 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
attacttatt |
tRNA gene sequence |
GCGGGCGTGGTTTAGTGGTAAAACCTCAGCCTTCCAAGCTGAAGATGCGGGTTCGATTCC |
Downstream region at tRNA end position |
agattatatt |
Secondary structure (Cloverleaf model) | >WENV170124793 Gly TCC t Tttt agattatatt G - C C - G G - C G - C G - C C - G G - C T T T C G C C C A G A G | | | | | G T T T T G G C G G G C G | | | | T T G A A A C T A C AGAT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |