Sequence ID | >WENV170129292 |
Genome ID | CENQ01079939 |
Search identical group | |
Phylum/Class | [CENQ] marine metagenome genome assembly TARA_031_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 181 |
End posion on genome | 255 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atattttcat |
tRNA gene sequence |
GTCTCGGTAGCTCAGCTGGTTAGAGCGGCGGATTCATAGCCCGCAGGTCGCGTGTTCAAG |
Downstream region at tRNA end position |
caattacttt |
Secondary structure (Cloverleaf model) | >WENV170129292 Met CAT t ACtt caattacttt G - C T - A C - G T - A C - G G - C G + T T G T C G C A C A C G A A | | | | | A T C T C G G C G T G C G | | | | T T G G A G C T T A G AGGTC G - C C - G G - C G - C A C T G T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |