Sequence ID | >WENV170129698 |
Genome ID | CENQ01123661 |
Search identical group | |
Phylum/Class | [CENQ] marine metagenome genome assembly TARA_031_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 364 |
End posion on genome | 291 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
attgattcta |
tRNA gene sequence |
GGCGGGTTGGCGGAGTGGTGACGCAGCGGATTGCAAATCCGTGTACACCGGTTCGATTCC |
Downstream region at tRNA end position |
aaaaaattct |
Secondary structure (Cloverleaf model) | >WENV170129698 Cys GCA a TCCA aaaaaattct G - C G - C C - G G - C G - C G - C T - A T T T T G G C C A G A G | | | | | G T G G C G A C C G G C G | | | T T G A C G C T G A GTAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |