Sequence ID | >WENV170144266 |
Genome ID | CENY01139395 |
Search identical group | |
Phylum/Class | [CENY] marine metagenome genome assembly TARA_032_DCM_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 354 |
End posion on genome | 281 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ttcataactt |
tRNA gene sequence |
GGCTGGGTGGCAGAGTGGTTATGCAGCGGCCTGCAAAGCCGTGGACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
ttaccccttc |
Secondary structure (Cloverleaf model) | >WENV170144266 Cys GCA t TCCA ttaccccttc G - C G - C C - G T - A G - C G - C G - C T T T C A G C C A G A G | | | | G T G A C G G C C G G C G | | | T T G A T G C T T A GGAC G + T C - G G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |