Sequence ID | >WENV170146313 |
Genome ID | CENZ01046266 |
Search identical group | |
Phylum/Class | [CENZ] marine metagenome genome assembly TARA_025_DCM_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 2625 |
End posion on genome | 2554 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ttttcaaaac |
tRNA gene sequence |
GGTACTCTGGCAGAACGGTTATGCGTGAGCCTGCAAAGCTTATACAAGGGGGTTCGACTC |
Downstream region at tRNA end position |
ttctacaatt |
Secondary structure (Cloverleaf model) | >WENV170146313 Cys GCA c Ttta ttctacaatt G - C G - C T - A A - T C - G T + G C - G T C T C T C C C A A A G | + | | | G C G A C G G G G G G C G | | | T T G A T G C T T G TACAA T - A G + T A - T G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |