Sequence ID | >WENV170146716 |
Genome ID | CENZ01074759 |
Search identical group | |
Phylum/Class | [CENZ] marine metagenome genome assembly TARA_025_DCM_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 1141 |
End posion on genome | 1067 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gtagaagttt |
tRNA gene sequence |
TGGGGTGTCGCCAAGTGGTAAGGCACTGGGTTTTGATCCCAGCATTCCCAGGTTCGAATC |
Downstream region at tRNA end position |
tattttggca |
Secondary structure (Cloverleaf model) | >WENV170146716 Gln TTG t GCCA tattttggca T - A G - C G - C G - C G - C T - A G - C T A T G G T C C A G A C | | | | | G T A C C G C C A G G C G | | | T T G A G G C T A A CATTC C - G T - A G - C G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |