| Sequence ID | >WENV170162039 |
| Genome ID | CEOL01088739 |
| Phylum/Class | [CEOL] marine metagenome genome assembly TARA_038_SRF_0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
| Species | |
|
Start position on genome
|
1295
|
|
End posion on genome
|
1221
|
|
Amino Acid
|
Gly
|
|
Anticodon
|
GCC
|
|
Upstream region at tRNA start position
|
nnnnnnnnnn
|
|
tRNA gene sequence
|
GCGGGCGTAGCTCAGGGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGAGAGTTCGAATC TCTTCGCCCGCTCCA
|
|
Downstream region at tRNA end position
|
atttttctca
|
| Secondary structure (Cloverleaf model) | >WENV170162039 Gly GCC
n TCCA atttttctca
G - C
C - G
G - C
G - C
G - C
C - G
G - C T A
T T T C T C A
G A A + | | | | G
G C T C G G A G A G C
G | | | | T T
G G A G C
T A A GGGTC
C - G
A - T
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |