Sequence ID | >WENV170162185 |
Genome ID | CEOM01009372 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 408 |
End posion on genome | 483 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
taaattaatt |
tRNA gene sequence |
GGGGCTATAGCTCAGCTGGGAGAGCGCTTGCGTGGCACGCAAGAGGTCCGCGGTTCGATC |
Downstream region at tRNA end position |
aatcaacatg |
Secondary structure (Cloverleaf model) | >WENV170162185 Ala GGC t ACCA aatcaacatg G - C G - C G + T G - C C - G T - A A - T C T T G C G C C A C G A A | | | | | G T C T C G C G C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A G - C C - G G C T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |