Sequence ID | >WENV170162194 |
Genome ID | CEOM01010258 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 180 |
End posion on genome | 104 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
aaaattaata |
tRNA gene sequence |
GCGCCTGTAGCTCAGCTGGATAGAGTACTTGGCTTCGAACCAAGGGGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
gttattttga |
Secondary structure (Cloverleaf model) | >WENV170162194 Arg TCG a GCCA gttattttga G - C C - G G - C C - G C - G T + G G - C T A T C C T T C A C G A A | | + | | G T C T C G G G G A G C G | | | + T T G G A G T A T A A GGGTC C - G T - A T - A G - C G - C C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |