Sequence ID | >WENV170162325 |
Genome ID | CEOM01020115 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 180 |
End posion on genome | 105 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aatccccgta |
tRNA gene sequence |
GCCCAAATAGCTCAATTGGTAGAGCAACTGATTTGTAATCAGTAGGTTGGGAGTTCGATT |
Downstream region at tRNA end position |
ccaacaacaa |
Secondary structure (Cloverleaf model) | >WENV170162325 Thr TGT a ACCA ccaacaacaa G - C C - G C - G C - G A - T A - T A - T T T T C T C T C A T A A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A A AGGTT A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |