Sequence ID | >WENV170162411 |
Genome ID | CEOM01027972 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 557 |
End posion on genome | 631 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ttccctttag |
tRNA gene sequence |
AGTCTCGTAGCTCAGCTGGTTAGAGCGCTACACTGATAATGTAGAGGTCGGCAGTTCGAG |
Downstream region at tRNA end position |
taaaaaaggg |
Secondary structure (Cloverleaf model) | >WENV170162411 Ile GAT g ACat taaaaaaggg A - T G - C T - A C - G T - A C - G G - C T G T C C G T C A C G A A | | | | | G T C T C G G G C A G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T C - G A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |