Sequence ID | >WENV170162507 |
Genome ID | CEOM01036664 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 321 |
End posion on genome | 405 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
caaaagaata |
tRNA gene sequence |
GGGGAGATACTCAAGCGGCCAACGAGGGCAGACTGTAAATCTGTTGTTTTTAACTTCGCA |
Downstream region at tRNA end position |
ctttatttta |
Secondary structure (Cloverleaf model) | >WENV170162507 Tyr GTA a ACAA ctttatttta G - C G - C G - C G - C A - T G - C A - T T A T C G T C C A C G A A | | | | | G G A C T C G C A G G C G | | | T T C C G A G C A A G TGTTTTTAACTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |