Sequence ID | >WENV170162821 |
Genome ID | CEOM01066820 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 222 |
End posion on genome | 148 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ctaataataT |
tRNA gene sequence |
GCTCCCGTAGTTTAAGTGGATAAAACGTTGGATTCCTAATCCGAAACTCTGGGTTCGAGT |
Downstream region at tRNA end position |
tcagataaaa |
Secondary structure (Cloverleaf model) | >WENV170162821 Arg CCT T ATac tcagataaaa G - C C - G T - A C - G C - G C - G G - C T G T G G C C C A G A A A | + | | | G T T T T G C T G G G C G | | | | T T G A A A C A T A G AACT T - A T + G G - C G - C A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |