Sequence ID | >WENV170162862 |
Genome ID | CEOM01070375 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 41 |
End posion on genome | 114 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
agaagatttT |
tRNA gene sequence |
TGGAATATAGCCAAAAGGCAAGGCATTCGTTTTTGGTACGAATATTTGAAGGTTCGAATC |
Downstream region at tRNA end position |
atacaatcta |
Secondary structure (Cloverleaf model) | >WENV170162862 Gln TTG T AAaa atacaatcta T - A G - C G - C A - T A - T T - A A - T T A T C T T C C A A A A | | | | | G A A C C G G A A G G C G | | | T T G A G G C C A A TATTT T - A T - A C - G G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |