Sequence ID | >WENV170163029 |
Genome ID | CEOM01087174 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 251 |
End posion on genome | 325 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aaagaaagtt |
tRNA gene sequence |
GGTCCCATCGTCTAGTGGTTAGGACATCAGGTTTTCATCCTGGCAACCGGGGTTCGATTC |
Downstream region at tRNA end position |
ctttttgtgc |
Secondary structure (Cloverleaf model) | >WENV170163029 Glu TTC t ACCA ctttttgtgc G + T G - C T - A C - G C - G C - G A - T T T T G C C C C A T G A C | | | | | G G T C T G C G G G G C G + | | | T T T G G A C T A A CAAC T + G C - G A - T G - C G - C T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |