Sequence ID | >WENV170163102 |
Genome ID | CEOM01095100 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 379 |
End posion on genome | 455 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tggtgtttgg |
tRNA gene sequence |
CGCGGGGTGGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
aaaataatta |
Secondary structure (Cloverleaf model) | >WENV170163102 Met CAT g ACCA aaaataatta C A G - C C - G G - C G - C G - C G - C T A T C A T C C A C G A G | | | | | A C C G A G G T A G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |