Sequence ID | >WENV170163120 |
Genome ID | CEOM01096726 |
Search identical group | |
Phylum/Class | [CEOM] marine metagenome genome assembly TARA_004_SRF_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 263 |
End posion on genome | 336 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gaaatcgcat |
tRNA gene sequence |
TGGCGATTCGTCTAGCGGTAGGACCCCAGACTCTGAATCTGGTAGCCCAGGTTCGAATCC |
Downstream region at tRNA end position |
gatttggccc |
Secondary structure (Cloverleaf model) | >WENV170163120 Gln CTG t GCCA gatttggccc T - A G - C G - C C - G G - C A - T T - A T A T G G T C C A G A C | | | | | G C T C T G C C A G G C G + | | | T T G G G A C T A C TAGC C - G C - G A - T G - C A - T C A T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |